ID: 1098834629_1098834634

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1098834629 1098834634
Species Human (GRCh38) Human (GRCh38)
Location 12:75407160-75407182 12:75407182-75407204
Sequence CCTACTCCATGGCTATAAATCCC CCACTTATCCTTGCTGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 114, 4: 331} {0: 1, 1: 2, 2: 7, 3: 45, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!