ID: 1098836085_1098836088

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1098836085 1098836088
Species Human (GRCh38) Human (GRCh38)
Location 12:75425673-75425695 12:75425707-75425729
Sequence CCTGACATCACTTATTTTTATTT GTGTCTAAGCAGAGTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 117, 4: 1082} {0: 1, 1: 1, 2: 4, 3: 33, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!