ID: 1098841395_1098841399

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1098841395 1098841399
Species Human (GRCh38) Human (GRCh38)
Location 12:75482536-75482558 12:75482560-75482582
Sequence CCTACTGTGTGCCATGCACTAGG ACCACGCACGGTGCTACACAAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 51, 3: 408, 4: 1846} {0: 1, 1: 0, 2: 1, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!