ID: 1098975167_1098975170

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1098975167 1098975170
Species Human (GRCh38) Human (GRCh38)
Location 12:76895096-76895118 12:76895132-76895154
Sequence CCTTCAGGCAAAAGCAAAATGAT CTGTATCTGCAAAAGGAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 23, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!