ID: 1098990499_1098990506

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1098990499 1098990506
Species Human (GRCh38) Human (GRCh38)
Location 12:77060221-77060243 12:77060266-77060288
Sequence CCTCCATTAGAGTGTCCTGTGAA TAAATAGAGGTAATATACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104} {0: 1, 1: 0, 2: 1, 3: 11, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!