ID: 1099014118_1099014132

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1099014118 1099014132
Species Human (GRCh38) Human (GRCh38)
Location 12:77324926-77324948 12:77324962-77324984
Sequence CCCGCGGGCTGCTAGGTGGCGGC GAGGCGCGGCCCGGCGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 93} {0: 1, 1: 1, 2: 2, 3: 66, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!