ID: 1099055912_1099055914

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1099055912 1099055914
Species Human (GRCh38) Human (GRCh38)
Location 12:77840423-77840445 12:77840436-77840458
Sequence CCAAAATACAGATGAGGAGAATA GAGGAGAATATGATGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 492} {0: 1, 1: 0, 2: 2, 3: 18, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!