ID: 1099075133_1099075140

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1099075133 1099075140
Species Human (GRCh38) Human (GRCh38)
Location 12:78097100-78097122 12:78097136-78097158
Sequence CCTGAGAGCAGCTGGCAGTGTTT AGGTTAGGTCATCAGCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 219} {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!