ID: 1099105057_1099105060

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1099105057 1099105060
Species Human (GRCh38) Human (GRCh38)
Location 12:78486637-78486659 12:78486652-78486674
Sequence CCATGAGGGACCTGCCTGTGTAG CTGTGTAGCAAACTTGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 521} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!