ID: 1099147344_1099147350

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1099147344 1099147350
Species Human (GRCh38) Human (GRCh38)
Location 12:79063518-79063540 12:79063553-79063575
Sequence CCCTATGTCTGCTTGTAAACCAA ATTTACACATAAGTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167} {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!