ID: 1099171155_1099171161

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1099171155 1099171161
Species Human (GRCh38) Human (GRCh38)
Location 12:79366391-79366413 12:79366443-79366465
Sequence CCTTAAAAGCCTCCCATCAGGAA CCCTGACCTTGCCAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140} {0: 1, 1: 0, 2: 2, 3: 22, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!