ID: 1099187837_1099187844

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1099187837 1099187844
Species Human (GRCh38) Human (GRCh38)
Location 12:79535109-79535131 12:79535157-79535179
Sequence CCTCATCTCTCCTAAAAATACAA GCCTGTAGGCCCAGCTACTCAGG
Strand - +
Off-target summary No data {0: 224, 1: 73729, 2: 193874, 3: 239059, 4: 178816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!