ID: 1099204266_1099204273

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1099204266 1099204273
Species Human (GRCh38) Human (GRCh38)
Location 12:79710768-79710790 12:79710802-79710824
Sequence CCTCGCTGACTCTTGGTGCCTCC GCCCACTCTGGCCGCGCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 22, 2: 100, 3: 360, 4: 853} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!