ID: 1099222208_1099222212

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1099222208 1099222212
Species Human (GRCh38) Human (GRCh38)
Location 12:79928422-79928444 12:79928462-79928484
Sequence CCAGTTTGGGGTTGGGAGGGTTT AGGTTTTTAAAAATGGATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 224} {0: 1, 1: 1, 2: 14, 3: 118, 4: 1029}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!