ID: 1099251186_1099251187

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1099251186 1099251187
Species Human (GRCh38) Human (GRCh38)
Location 12:80256955-80256977 12:80256968-80256990
Sequence CCAGAACTAAATTGGTTTTGCTA GGTTTTGCTACAGCAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142} {0: 1, 1: 0, 2: 3, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!