ID: 1099256966_1099256968

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1099256966 1099256968
Species Human (GRCh38) Human (GRCh38)
Location 12:80326105-80326127 12:80326121-80326143
Sequence CCTGCAGTACTTGAGGAAGGACT AAGGACTCAAATACTGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 7, 4: 119} {0: 1, 1: 0, 2: 0, 3: 16, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!