ID: 1099260955_1099260959

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1099260955 1099260959
Species Human (GRCh38) Human (GRCh38)
Location 12:80382309-80382331 12:80382350-80382372
Sequence CCACTCCACTTCTGCTCATGCAG GCTCATAGTTCTGCAGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 348} {0: 1, 1: 0, 2: 1, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!