ID: 1099283485_1099283487

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1099283485 1099283487
Species Human (GRCh38) Human (GRCh38)
Location 12:80684212-80684234 12:80684232-80684254
Sequence CCGCGGTGAAGTGCAGGAGGTTT TTTTAGAGATGAGCTTGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 15, 3: 33, 4: 139} {0: 1, 1: 90, 2: 106, 3: 114, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!