ID: 1099296198_1099296200

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1099296198 1099296200
Species Human (GRCh38) Human (GRCh38)
Location 12:80830951-80830973 12:80830986-80831008
Sequence CCTCCTTACGCTGTACTGATTAA TTGCCATCTCTAACACTATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!