ID: 1099325304_1099325306

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1099325304 1099325306
Species Human (GRCh38) Human (GRCh38)
Location 12:81207719-81207741 12:81207758-81207780
Sequence CCTTGAGTCAACTAGCTAGTTGA CTCATTCTTCTGTGCTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 1, 2: 2, 3: 19, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!