ID: 1099365055_1099365067

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1099365055 1099365067
Species Human (GRCh38) Human (GRCh38)
Location 12:81758557-81758579 12:81758578-81758600
Sequence CCTCCCGGAACGTGCCCCGGCCC CCGGTGGCGTGGCAGGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 418} {0: 1, 1: 0, 2: 13, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!