ID: 1099403216_1099403220

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1099403216 1099403220
Species Human (GRCh38) Human (GRCh38)
Location 12:82225799-82225821 12:82225824-82225846
Sequence CCATCCTCAACCTACTTCTCCTT TCACCTCCCACTAGAGCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 73, 4: 849} {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!