ID: 1099416469_1099416471

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1099416469 1099416471
Species Human (GRCh38) Human (GRCh38)
Location 12:82393289-82393311 12:82393332-82393354
Sequence CCTCATCAATTTATTTCATCAAT GAGATCTTTAACTTCTTTGGTGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 193, 3: 804, 4: 1597} {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!