ID: 1099574271_1099574283

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1099574271 1099574283
Species Human (GRCh38) Human (GRCh38)
Location 12:84361667-84361689 12:84361705-84361727
Sequence CCCCACAGCCTGCTGCCCAGGGG TAGACAAGGTCATCTGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 63, 4: 511} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!