ID: 1099605548_1099605559

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1099605548 1099605559
Species Human (GRCh38) Human (GRCh38)
Location 12:84797583-84797605 12:84797622-84797644
Sequence CCCATCCCTAGATATATCCTGGG CATTTTATCTACCCCAACCACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!