ID: 1099631514_1099631518

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1099631514 1099631518
Species Human (GRCh38) Human (GRCh38)
Location 12:85152317-85152339 12:85152341-85152363
Sequence CCCGCTTCCCTTCACAAACACTG TTCTTTCAAACCAGCTGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 294} {0: 1, 1: 0, 2: 1, 3: 25, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!