ID: 1099658711_1099658716

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1099658711 1099658716
Species Human (GRCh38) Human (GRCh38)
Location 12:85527835-85527857 12:85527853-85527875
Sequence CCCTCACTGGAGCATTGTCTAGT CTAGTGGAGCTGTGAGAAAGGGG
Strand - +
Off-target summary No data {0: 7, 1: 187, 2: 1981, 3: 2161, 4: 1512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!