ID: 1099713403_1099713406

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1099713403 1099713406
Species Human (GRCh38) Human (GRCh38)
Location 12:86259266-86259288 12:86259297-86259319
Sequence CCTTTGGAAAAAAGTCTGATGAT ATCAGTCTGCACATGTATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 372} {0: 1, 1: 0, 2: 1, 3: 46, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!