ID: 1099713895_1099713901

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1099713895 1099713901
Species Human (GRCh38) Human (GRCh38)
Location 12:86265198-86265220 12:86265240-86265262
Sequence CCATGTCAGGTGTGACATCCAGG GCAGCCTGCCAGGCCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 266} {0: 1, 1: 0, 2: 0, 3: 17, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!