ID: 1099725897_1099725900

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1099725897 1099725900
Species Human (GRCh38) Human (GRCh38)
Location 12:86427497-86427519 12:86427550-86427572
Sequence CCATCCACCTTACACACACACAG ACACACCCTCTTATCCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 135, 4: 1212} {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!