ID: 1099749038_1099749042

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1099749038 1099749042
Species Human (GRCh38) Human (GRCh38)
Location 12:86747134-86747156 12:86747148-86747170
Sequence CCTCCAGTGCTCCTTATCCTGCA TATCCTGCAGGATTTCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193} {0: 1, 1: 0, 2: 3, 3: 20, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!