ID: 1099757787_1099757792

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1099757787 1099757792
Species Human (GRCh38) Human (GRCh38)
Location 12:86876910-86876932 12:86876939-86876961
Sequence CCCTCCTCCAAGCACACAGATTT CTGTGCCACATGACTACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 36, 3: 167, 4: 532} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!