ID: 1099881459_1099881461

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1099881459 1099881461
Species Human (GRCh38) Human (GRCh38)
Location 12:88471954-88471976 12:88471977-88471999
Sequence CCTCTTTAGACACACTTCCTTCT TGCTCAGCAAAACTGCTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!