ID: 1099947186_1099947190

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1099947186 1099947190
Species Human (GRCh38) Human (GRCh38)
Location 12:89258123-89258145 12:89258139-89258161
Sequence CCCATCTAAGCCTATTTTCTAGA TTCTAGATAACCAGAAGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!