ID: 1100091693_1100091694

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1100091693 1100091694
Species Human (GRCh38) Human (GRCh38)
Location 12:90980121-90980143 12:90980134-90980156
Sequence CCAGGAAGAGCGGAAATTGAGAC AAATTGAGACAGATGTTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113} {0: 1, 1: 0, 2: 3, 3: 148, 4: 2272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!