ID: 1100092391_1100092398

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1100092391 1100092398
Species Human (GRCh38) Human (GRCh38)
Location 12:90986679-90986701 12:90986722-90986744
Sequence CCAGCCAGCACTGTACCAACCTA AGTGCAAACCAGCAGCACATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!