ID: 1100210746_1100210749

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1100210746 1100210749
Species Human (GRCh38) Human (GRCh38)
Location 12:92396185-92396207 12:92396206-92396228
Sequence CCAGTTACTTGGTGCCTTGCTAC ACTCAAGGTGCAGCCAGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!