ID: 1100213381_1100213384

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1100213381 1100213384
Species Human (GRCh38) Human (GRCh38)
Location 12:92421694-92421716 12:92421713-92421735
Sequence CCTTCAGACTTAAACCAGGAGTT AGTTACACCTTTGGCTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 22, 4: 161} {0: 1, 1: 11, 2: 45, 3: 173, 4: 579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!