ID: 1100295694_1100295698

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1100295694 1100295698
Species Human (GRCh38) Human (GRCh38)
Location 12:93258825-93258847 12:93258859-93258881
Sequence CCTTCCTCTTCATGCATACACAA GTGAAGAGGAAGTGAGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!