ID: 1100309818_1100309823

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1100309818 1100309823
Species Human (GRCh38) Human (GRCh38)
Location 12:93383886-93383908 12:93383925-93383947
Sequence CCTCTTCATTCTTAGGGGTCACT GCTCCTCCGCTCCCCTTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108} {0: 1, 1: 0, 2: 9, 3: 42, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!