ID: 1100328818_1100328828

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1100328818 1100328828
Species Human (GRCh38) Human (GRCh38)
Location 12:93567033-93567055 12:93567085-93567107
Sequence CCAAGAGCTCGAGTCATTCCCAT GAGTGCATCCCAGGATCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100} {0: 2, 1: 0, 2: 2, 3: 9, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!