ID: 1100331897_1100331903

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1100331897 1100331903
Species Human (GRCh38) Human (GRCh38)
Location 12:93590676-93590698 12:93590717-93590739
Sequence CCCAGCTACTCCGGAGGCTGAGG CCCAGCAGGCAGAGCCGAGATGG
Strand - +
Off-target summary {0: 4636, 1: 212588, 2: 277873, 3: 178664, 4: 92980} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!