ID: 1100331899_1100331903

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1100331899 1100331903
Species Human (GRCh38) Human (GRCh38)
Location 12:93590677-93590699 12:93590717-93590739
Sequence CCAGCTACTCCGGAGGCTGAGGC CCCAGCAGGCAGAGCCGAGATGG
Strand - +
Off-target summary {0: 4367, 1: 193744, 2: 258218, 3: 182337, 4: 105179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!