ID: 1100391623_1100391634

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1100391623 1100391634
Species Human (GRCh38) Human (GRCh38)
Location 12:94149571-94149593 12:94149612-94149634
Sequence CCACGACACGGCCATCGCGCTCA GCCTGGCCACGCAGGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30} {0: 1, 1: 0, 2: 1, 3: 49, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!