ID: 1100391915_1100391918

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1100391915 1100391918
Species Human (GRCh38) Human (GRCh38)
Location 12:94150852-94150874 12:94150869-94150891
Sequence CCTGGGGCTGAACCAGGCAAGCG CAAGCGATACAGGTTTCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 177} {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!