ID: 1100399763_1100399765

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1100399763 1100399765
Species Human (GRCh38) Human (GRCh38)
Location 12:94218847-94218869 12:94218865-94218887
Sequence CCACCTTCTTTAATCATTATCTA ATCTAACAATATTAGCAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 299} {0: 1, 1: 0, 2: 1, 3: 19, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!