ID: 1100400080_1100400085

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1100400080 1100400085
Species Human (GRCh38) Human (GRCh38)
Location 12:94221764-94221786 12:94221778-94221800
Sequence CCTTGTTGCTGTATTCTCACATA TCTCACATACAGAAGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 49, 3: 347, 4: 1318} {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!