ID: 1100409393_1100409397

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1100409393 1100409397
Species Human (GRCh38) Human (GRCh38)
Location 12:94299965-94299987 12:94299985-94300007
Sequence CCAGGACAGTAGAGCTGTTGGGA GGAGACCTAGCAGCATATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} {0: 1, 1: 1, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!