ID: 1100416664_1100416673

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1100416664 1100416673
Species Human (GRCh38) Human (GRCh38)
Location 12:94385112-94385134 12:94385152-94385174
Sequence CCACTCTACTTCTGTTGATACCC CATGATACCCATAATGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 150} {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!