ID: 1100433155_1100433165

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1100433155 1100433165
Species Human (GRCh38) Human (GRCh38)
Location 12:94548248-94548270 12:94548296-94548318
Sequence CCCCCATGGCAGCGCAGGCCTGG TGCCCCGCTTCCTGGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 254} {0: 1, 1: 1, 2: 7, 3: 23, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!